si:ch211-272n13.3

Ensembl ID:
ENSDARG00000013015
ZFIN ID:
ZDB-GENE-081104-216
Description:
LOC402845 protein [Source:UniProtKB/TrEMBL;Acc:Q7T2P5]
Human Orthologues:
AC012414.1, AC018892.1, AC073995.2, AL136981.1, AL137218.1, AL163540.1, ANKRD18A, ANKRD18B, ANKRD20A1, ANKRD20A2, ANKRD20A3, ANKRD20A4, ANKRD26, ANKRD26P1, ANKRD30A, ANKRD30B, ANKRD30BL, ANKRD36B, ANKRD62, ANKRD7, BX072566.2, CR769776.1, POTEB, POTEC, POTED, POTEE, POTEF, POTEG, POTEH, POTEI, POTEJ, POTEM
Human Descriptions:
ankyrin repeat domain 18A [Source:HGNC Symbol;Acc:23643]
ankyrin repeat domain 18B [Source:HGNC Symbol;Acc:23644]
ankyrin repeat domain 20 family, member A1 [Source:HGNC Symbol;Acc:23665]
ankyrin repeat domain 20 family, member A2 [Source:HGNC Symbol;Acc:31979]
ankyrin repeat domain 20 family, member A3 [Source:HGNC Symbol;Acc:31981]
ankyrin repeat domain 20 family, member A4 [Source:HGNC Symbol;Acc:31982]
ankyrin repeat domain 26 pseudogene 1 [Source:HGNC Symbol;Acc:32955]
ankyrin repeat domain 26 [Source:HGNC Symbol;Acc:29186]
ankyrin repeat domain 30A [Source:HGNC Symbol;Acc:17234]
ankyrin repeat domain 30B [Source:HGNC Symbol;Acc:24165]
ankyrin repeat domain 30B-like [Source:HGNC Symbol;Acc:35167]
ankyrin repeat domain 36B [Source:HGNC Symbol;Acc:29333]
ankyrin repeat domain 62 [Source:HGNC Symbol;Acc:35241]
ankyrin repeat domain 7 [Source:HGNC Symbol;Acc:18588]
Ankyrin repeat domain-containing protein 36C [Source:UniProtKB/Swiss-Prot;Acc:Q5JPF3]
POTE ankyrin domain family member D [Source:UniProtKB/Swiss-Prot;Acc:Q86YR6]
POTE ankyrin domain family, member B [Source:HGNC Symbol;Acc:33734]
POTE ankyrin domain family, member C [Source:HGNC Symbol;Acc:33894]
POTE ankyrin domain family, member D [Source:HGNC Symbol;Acc:23822]
POTE ankyrin domain family, member E [Source:HGNC Symbol;Acc:33895]
POTE ankyrin domain family, member F [Source:HGNC Symbol;Acc:33905]
POTE ankyrin domain family, member G [Source:HGNC Symbol;Acc:33896]
POTE ankyrin domain family, member H [Source:HGNC Symbol;Acc:133]
POTE ankyrin domain family, member I [Source:HGNC Symbol;Acc:37093]
POTE ankyrin domain family, member J [Source:HGNC Symbol;Acc:37094]
POTE ankyrin domain family, member M [Source:HGNC Symbol;Acc:37096]
POTEB protein [Source:UniProtKB/TrEMBL;Acc:Q495V5]
Putative ankyrin repeat domain-containing protein 19 [Source:UniProtKB/Swiss-Prot;Acc:Q9H560]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NIK4]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B9ZVA0]
Mouse Orthologues:
4930430A15Rik, 4930467E23Rik, 4931423N10Rik, AC140205.2, AC154265.1, AC161343.1, AC164531.1, AC168205.1, Ankrd26, Ankrd36, Ankrd7, Ccdc144b, Gm15319, Poteg
Mouse Descriptions:
ankyrin repeat domain 26 Gene [Source:MGI Symbol;Acc:MGI:1917887]
ankyrin repeat domain 36 Gene [Source:MGI Symbol;Acc:MGI:1923639]
ankyrin repeat domain 7 Gene [Source:MGI Symbol;Acc:MGI:1922446]
coiled-coil domain containing 144B Gene [Source:MGI Symbol;Acc:MGI:2681852]
POTE ankyrin domain family, member G Gene [Source:MGI Symbol;Acc:MGI:1918202]
predicted gene 15319 Gene [Source:MGI Symbol;Acc:MGI:3796981]
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9D5C0]
RIKEN cDNA 4930430A15 gene Gene [Source:MGI Symbol;Acc:MGI:1914825]
RIKEN cDNA 4930467E23 gene Gene [Source:MGI Symbol;Acc:MGI:1923056]
RIKEN cDNA 4931423N10 gene Gene [Source:MGI Symbol;Acc:MGI:1918231]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44217 Nonsense Mutation detected in F1 DNA During 2017
sa31105 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30186 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021089   None 306 None 7
ENSDART00000130115 Nonsense 407 2274 10 41
ENSDART00000132372   None 488 None 10
ENSDART00000147558   None 892 None 14
Genomic Location (Zv9):
Chromosome 25 (position 3594481)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3508589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACCTACCTCCAACCCCCTGTAGAAACCGCCTCTTTGCCCCACCCACCC[C/T]AGATGAGCTCCACCCCCTTCAGCAGCACCCTTAAGGTAAACCCTTGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021089   None 306 None 7
ENSDART00000130115 Essential Splice Site 1657 2274 29 41
ENSDART00000132372   None 488 None 10
ENSDART00000147558 Essential Splice Site 797 892 12 14
Genomic Location (Zv9):
Chromosome 25 (position 3633963)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3469107
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCCGAGAGCAGAACTATAAACTAGAGCAGGAGAAGGCGGACCGAGAG[G/A]TACAGACATGCAGATTATTGATTTATTTTTTTTTACTTTTTAAATATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30186
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021089   None 306 None 7
ENSDART00000130115 Essential Splice Site 2224 2274 40 41
ENSDART00000132372 Essential Splice Site 438 488 9 10
ENSDART00000147558   None 892 None 14
Genomic Location (Zv9):
Chromosome 25 (position 3653279)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3449791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATGCAGACCGAGCTGGAGAAGAATATATCGAAGGAGCTGGACTGTGG[T/A]GAGTTGTTATTACAGACACATATCCTTATCATCAAATCTGGAGGAGTTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link