LOC558410

Ensembl ID:
ENSDARG00000013009
Human Orthologue:
UBIAD1
Human Description:
UbiA prenyltransferase domain containing 1 [Source:HGNC Symbol;Acc:30791]
Mouse Orthologue:
Ubiad1
Mouse Description:
UbiA prenyltransferase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918957]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31690 Nonsense Available for shipment Available now
sa34525 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31690
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015554 Nonsense 71 336 1 2
Genomic Location (Zv9):
Chromosome 8 (position 55643260)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53590918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTCAGCGCGTCTCTCACGCCCGTGGCTCTGGGCAGCGCTCTGGCCTA[C/A]AAGCTGGAGGGCTCGGTGGACCTGCTGCTGCTGCTGGTGTGCGCGGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34525
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015554 Essential Splice Site 175 336 1 2
Genomic Location (Zv9):
Chromosome 8 (position 55642948)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53590606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCTCATTTATTTTGGAGGACTGTCCAGCTCGTTTCTCTACACCGGAGG[T/G]GAATATACCGATTGGCTTCCTTTAACTCCACTCGGGGCTCTTAAAGCGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link