adrbk2

Ensembl ID:
ENSDARG00000013007
ZFIN ID:
ZDB-GENE-030616-382
Description:
beta-adrenergic receptor kinase 2 [Source:RefSeq peptide;Acc:NP_001128197]
Human Orthologue:
ADRBK1
Human Description:
adrenergic, beta, receptor kinase 1 [Source:HGNC Symbol;Acc:289]
Mouse Orthologue:
Adrbk1
Mouse Description:
adrenergic receptor kinase, beta 1 Gene [Source:MGI Symbol;Acc:MGI:87940]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5588 Nonsense F2 line generated During 2014
sa2558 Nonsense F2 line generated During 2014
sa2560 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa5588
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022369 Nonsense 462 688 16 21
ENSDART00000134164 Nonsense 143 278 5 8
ENSDART00000022369 Nonsense 462 688 16 21
ENSDART00000134164 Nonsense 143 278 5 8
Genomic Location:
Chromosome 10 (position 45894608)
KASP Assay ID:
554-3099.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTGAAGGAKCACGTGTTCTTCAAGGGAATCGATTGGCAGCAGGTTTA[T/A]CTCCAGAAGGTGAGACCTTTGCCCTTTTTCTTTTCTTTTATCGAGCCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2558
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022369 Nonsense 462 688 16 21
ENSDART00000134164 Nonsense 143 278 5 8
ENSDART00000022369 Nonsense 462 688 16 21
ENSDART00000134164 Nonsense 143 278 5 8
Genomic Location:
Chromosome 10 (position 45894608)
KASP Assay ID:
554-3099.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTGAAGGAKCACGTGTTCTTCAAGGGAATCGATTGGCAGCAGGTTTA[T/A]CTCCAGAAGGTGAGACCTTTGCCCTTTTTCTTTTCTTTTATCGAGCCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2560
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022369 Nonsense 582 688 19 21
ENSDART00000134164 Nonsense 263 278 8 8
ENSDART00000022369 Nonsense 582 688 19 21
ENSDART00000134164 Nonsense 263 278 8 8
Genomic Location:
Chromosome 10 (position 45913280)
KASP Assay ID:
554-3153.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAAGCTAGGAAACCCCTTCCTGACGCAGTGGCAGCGGCGCTATTTCTA[T/A]CTGTTCCCCAACCGTGTRGAGTGGAGAGGTGAAGGAGAGTCTCGGGTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k32uxf35