si:ch211-107n23.1

Ensembl ID:
ENSDARG00000013000
ZFIN ID:
ZDB-GENE-030131-7905
Description:
liprin-alpha-2 [Source:RefSeq peptide;Acc:NP_001038576]
Human Orthologue:
PPFIA2
Human Description:
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), al
Mouse Orthologue:
Ppfia2
Mouse Description:
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), al

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2166 Essential Splice Site F2 line generated During 2017
sa33462 Nonsense Mutation detected in F1 DNA During 2017
sa31397 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2166
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034834 Essential Splice Site 151 1154 4 28
ENSDART00000142140 Essential Splice Site 233 1236 5 29
Genomic Location (Zv9):
Chromosome 4 (position 20952159)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22295494
KASP Assay ID:
554-3221.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAGAGGACCTGTTGGAGGGGACTGATGCCCAGAAACTTCATAGCAAGG[T/C]TAGTATTGACTGCTGCCAGGATTNNNACTCCCTCAGAGCAGTTCATTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034834 Nonsense 1080 1154 26 28
ENSDART00000142140 Nonsense 1162 1236 27 29
Genomic Location (Zv9):
Chromosome 4 (position 20910521)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22253856
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTCTAGAGAGGGAATACAACAATCTGCTGGCACTGGGAACAGAGAGA[C/T]GATTAGATGAGGTCAAGCTGTAGTTTTTTGTCTTTTATATAGAACTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31397
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034834 Nonsense 1152 1154 28 28
ENSDART00000142140 Nonsense 1234 1236 29 29
Genomic Location (Zv9):
Chromosome 4 (position 20898015)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22241350
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGGACCTTCAGCAGTACAGCGTCTGGACAGCTCCACTGTGAGGACCTA[C/A]TCTTGCTGAGATCTGCGTCTGCGCCACAAGCTGTGAGTTCACCTCTTTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link