actr5

Ensembl ID:
ENSDARG00000012995
ZFIN ID:
ZDB-GENE-040426-2877
Description:
actin-related protein 5 [Source:RefSeq peptide;Acc:NP_998653]
Human Orthologue:
ACTR5
Human Description:
ARP5 actin-related protein 5 homolog (yeast) [Source:HGNC Symbol;Acc:14671]
Mouse Orthologue:
Actr5
Mouse Description:
ARP5 actin-related protein 5 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1924748]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21407 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012419 Nonsense 400 592 6 9
Genomic Location:
Chromosome 9 (position 146113)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCGTCGGCAGATGAAGGAAACGAGCTGGAAGCAGAACTAAATGAGAAC[G/T]AAGAGCCTGGAAAACCCAGCAGCACAGCGCAGGTAACATTTAAAGACGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i0j4qcv6