gpia

Ensembl ID:
ENSDARG00000012987
ZFIN ID:
ZDB-GENE-020513-2
Description:
glucose phosphate isomerase a [Source:RefSeq peptide;Acc:NP_658909]
Human Orthologue:
GPI
Human Description:
glucose-6-phosphate isomerase [Source:HGNC Symbol;Acc:4458]
Mouse Orthologues:
Gm1840, Gpi1
Mouse Descriptions:
glucose phosphate isomerase 1 Gene [Source:MGI Symbol;Acc:MGI:95797]
predicted gene 1840 Pseudogene [Source:MGI Symbol;Acc:MGI:3037698]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44355 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31115 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44356 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022437 Essential Splice Site 161 553 5 18
ENSDART00000022437 Essential Splice Site 161 553 5 18

The following transcripts of ENSDARG00000012987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 37011234)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35418850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGCATCACTGATGTGGTGAACATCGGCATCGGAGGATCAGACCTGG[T/A]GAGTTTCCTAAAGCACCCCAGAACTGATTGTAAAGAAATCTGATCAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022437 Essential Splice Site 161 553 5 18
ENSDART00000022437 Essential Splice Site 161 553 5 18

The following transcripts of ENSDARG00000012987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 37011234)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35418850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGCATCACTGATGTGGTGAACATCGGCATCGGAGGATCAGACCTGG[T/A]GAGTTTCCTAAAGCACCCCAGAACTGATTGTAAAGAAATCTGATCAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022437 Essential Splice Site 267 553 9 18

The following transcripts of ENSDARG00000012987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 37013624)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35421240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGAAGGAGTTCGGCATCGACACCAACAACATGTTTGAGTTTTGGGAT[G/A]TGAGTATGTGCTACAGAGCAATTTCCAGGACAGACTGAATGCATGATTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link