ENSDARG00000012982

Ensembl ID:
ENSDARG00000012982
Human Orthologues:
AL929601.1, NF1, NF1P4, NF1P5
Human Descriptions:
neurofibromin 1 pseudogene 4 [Source:HGNC Symbol;Acc:7769]
neurofibromin 1 pseudogene 5 [Source:HGNC Symbol;Acc:7770]
neurofibromin 1 [Source:HGNC Symbol;Acc:7765]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9IYV8]
Mouse Orthologue:
Nf1
Mouse Description:
neurofibromatosis 1 Gene [Source:MGI Symbol;Acc:MGI:97306]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22673 Nonsense Available for shipment Available now
sa848 Nonsense Available for shipment Available now
sa10931 Nonsense Available for shipment Available now
sa22672 Nonsense Available for shipment Available now
sa32043 Nonsense Available for shipment Available now
sa35918 Nonsense Mutation detected in F1 DNA During 2016
sa39057 Nonsense Mutation detected in F1 DNA During 2016
sa22671 Nonsense Available for shipment Available now
sa35917 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39056 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080328 Nonsense 147 2805 4 58
Genomic Location (Zv9):
Chromosome 15 (position 30264972)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31086679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCACTCAGCTGCGCAGCTCCGCCTCTGCTGTGCTTTTCTCTCTCAGCTG[C/A]AACAACTTTAATGCCGTCTTCAGTCGTATCTCCACCAGGTACCTCTCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080328 Nonsense 316 2805 9 58
Genomic Location (Zv9):
Chromosome 15 (position 30260710)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31082417
KASP Assay ID:
554-0751.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTGTAGACAGTTTACGAAAGGCTCTTGGCCAACACAGCGGCAGCAAA[C/T]AATTGACGGAAAGTGCAGCTGTTGCATGCGTCAAACTCTGCAAAGCCTGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10931
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080328 Nonsense 479 2805 13 58
Genomic Location (Zv9):
Chromosome 15 (position 30258273)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31079980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTATTACTTGCAGAGTTTGACATTCAAAGAGAAAATGACAACAAGTT[T/A]GAAGTTCAAGGAAAAGTCCACAGATCTTGATTCGCGTTCTTTGCTGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080328 Nonsense 700 2805 20 58
Genomic Location (Zv9):
Chromosome 15 (position 30252855)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31074562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGTGTGTCTGTACACGTTCCTGTGGAGTCCTGATGCAGAGGCTGTTT[T/A]GGTGGCCATGTCCTGTTTCAGGCATCTCTGTGAGGAGGCCGATATTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32043
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080328 Nonsense 1244 2805 29 58
Genomic Location (Zv9):
Chromosome 15 (position 30240799)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31062506
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTGGCCAGAGTGTTAGTGACTCTCTTCGACTCTCGCCATCTGCTGTA[T/A]CAGCTGTTGTGGAATATGTTCTCCAAAGAGGTGGAGCTGGCAGACTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080328 Nonsense 2090 2805 42 58
Genomic Location (Zv9):
Chromosome 15 (position 30191800)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31013507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACGTCGTCACCCTGCTGGTGGCCACGGGCCCTCTCTCGCTGCGTGCAT[C/A]AACACACGGCCTGGTCATCAACATCATTCACTCGCTCTGCACATGCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080328 Nonsense 2232 2805 45 58
Genomic Location (Zv9):
Chromosome 15 (position 30186893)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31008600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGGGCGCTGGTGGTGTTCGGCTGCATCAGTAAACGAGTGACTCACGGA[C/T]AGCTAAAGCAGATCATTCGTATTCTCAGTAAAGCCAGTCCTCTACTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080328 Nonsense 2482 2805 51 58
Genomic Location (Zv9):
Chromosome 15 (position 30177928)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 30999635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCGAAAGTGTCAGAGCGCAGTCTTGCACCTCCGTACTCCACAATAGGG[C/T]AGACCAGCCTTCGTCCACGCAAATCCATGAGTGTAGACATGGGCCAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080328 Essential Splice Site 2548 2805 52 58
Genomic Location (Zv9):
Chromosome 15 (position 30177614)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 30999321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCACACCTCCAAAGATGAGGCGGGTTTCTGAAAATGACTATGAGATCG[G/T]TGAGTACTTATTGATTAGATGTGTGGTGCAACATTCCAGTGCTGAGGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080328 Nonsense 2638 2805 55 58
Genomic Location (Zv9):
Chromosome 15 (position 30175165)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 30996872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGCACAACCTGCTGGACTCCAAGTTAAGCACCGTCCTTTCCATGTGC[C/T]AGGACCCGAACCTTCTGAACCCCGTCCATGGCATCATTCAGAACGTGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link