osbpl7

Ensembl ID:
ENSDARG00000012981
ZFIN ID:
ZDB-GENE-041010-212
Description:
oxysterol binding protein-like 7 [Source:RefSeq peptide;Acc:NP_001005927]
Human Orthologue:
OSBPL7
Human Description:
oxysterol binding protein-like 7 [Source:HGNC Symbol;Acc:16387]
Mouse Orthologue:
Osbpl7
Mouse Description:
oxysterol binding protein-like 7 Gene [Source:MGI Symbol;Acc:MGI:1918490]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27969 Nonsense Mutation detected in F1 DNA During 2018
sa42049 Nonsense Mutation detected in F1 DNA During 2018
sa22120 Nonsense Available for shipment Available now
sa22119 Nonsense Available for shipment Available now
sa6256 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020667 Nonsense 176 888 6 22
Genomic Location (Zv9):
Chromosome 12 (position 30339198)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28676135
GRCz11 12 28791037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCACAGGATGTATAAAAAGAACGAGGCTGCGCACGTTCACAATGGCTA[T/A]CTCCAGGTCCTGTCCCATACCAGTAATTTATCTCACAAAACCAGTCCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020667 Nonsense 280 888 9 22
Genomic Location (Zv9):
Chromosome 12 (position 30336687)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28673624
GRCz11 12 28788526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAGTCATACATCTGTTTGATCCACAGAATCTTTCTCTTGACAAACCC[A/T]AAAAGAAATCCGCCAAGATTTTTGGTCACTCACGCACACTCTCCCGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22120
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020667 Nonsense 386 888 11 22
Genomic Location (Zv9):
Chromosome 12 (position 30334809)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28671746
GRCz11 12 28786648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGCGGGACACCTGGTCCGGCAGAGACCTTCACCAGAACACCTCTGCC[C/T]AGCTCAACAACCTCTGCAGTCTAGCTGAGGTGAGAAGGACTTCTGTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22119
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020667 Nonsense 493 888 14 22
Genomic Location (Zv9):
Chromosome 12 (position 30328427)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28665364
GRCz11 12 28780266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTATCAATTGAACAGCAATGGCATCTCGCAAATATCGAGCCAGCCTTT[C/A]GAAAGCAGCAGCAAAACCGAACACCATCAAGAGCACTGGACGGCGCACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020667 Nonsense 549 888 14 22
Genomic Location (Zv9):
Chromosome 12 (position 30328258)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28665195
GRCz11 12 28780097
KASP Assay ID:
554-5333.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGATCTGTCCCGGGTCTCCATGCCAGCAGCTCTGAATGAGCCTGTGTG[T/A]TTGCTGCAGAGACYCTGTGAGGAGCTGGAATATTCAGACCTGCTGGACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link