cfl1l

Ensembl ID:
ENSDARG00000012972
ZFIN ID:
ZDB-GENE-040426-2770
Description:
non-muscle cofilin 1 [Source:RefSeq peptide;Acc:NP_998804]
Human Orthologues:
CFL1, CFL2, DSTN
Human Descriptions:
cofilin 1 (non-muscle) [Source:HGNC Symbol;Acc:1874]
cofilin 2 (muscle) [Source:HGNC Symbol;Acc:1875]
destrin (actin depolymerizing factor) [Source:HGNC Symbol;Acc:15750]
Mouse Orthologues:
Cfl1, Cfl2, Dstn, Gm6180
Mouse Descriptions:
cofilin 1, non-muscle Gene [Source:MGI Symbol;Acc:MGI:101757]
cofilin 2, muscle Gene [Source:MGI Symbol;Acc:MGI:101763]
destrin Gene [Source:MGI Symbol;Acc:MGI:1929270]
predicted pseudogene 6180 Pseudogene [Source:MGI Symbol;Acc:MGI:3643972]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5863 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026464 Essential Splice Site 1 163 1 4
Genomic Location:
Chromosome 13 (position 33831518)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCAACGACACACTNNTCTCTCTCTTCTCCAAACAAGCGACAGACATGG[T/A]AAGTGCTCAGATTTTGGTGTACGTTTTGTGGACTGTACTRTAGTGTCCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5w7wubor