ENSDARG00000012949

Ensembl ID:
ENSDARG00000012949
Human Orthologue:
SCMH1
Human Description:
sex comb on midleg homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19003]
Mouse Orthologue:
Scmh1
Mouse Description:
sex comb on midleg homolog 1 Gene [Source:MGI Symbol;Acc:MGI:1352762]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8834 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18090 Essential Splice Site Available for shipment Available now
sa15449 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006669 Essential Splice Site 143 684 4 20
Genomic Location:
Chromosome 11 (position 31023773)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAACATTAAGTGGAGCAGAAATGGCTCCATCTTCAGCCTTTAAAAAG[G/A]TAATTTCTTTTWAAATCACAAAACCACATTAATAAGCTTTTTAAAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18090
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006669 Essential Splice Site 297 684 13 20
Genomic Location:
Chromosome 11 (position 31015412)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAAGCTTGCGCTGTATTTCAGTTGGTTTTGTTCTGAATGGGTTTTTT[A/C]RGATTACAGYTGGTACCGGATTGCGATGTGGGTAWCAGTCTGGACTTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006669 Essential Splice Site 346 684 15 20
Genomic Location:
Chromosome 11 (position 30998321)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTATTTGCTGGTTTTGAATTGTGCTTTATATTTGCGGTCATCTCTTCT[A/C]GTTTGTGTCTATGTGAATAAAYATRGTAACTCTGGRCCACACCTGGAYCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a2qvbj9j