myhz2

Ensembl ID:
ENSDARG00000012944
ZFIN ID:
ZDB-GENE-020604-1
Description:
myosin, heavy polypeptide 2, fast muscle specific [Source:RefSeq peptide;Acc:NP_694514]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8989 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6986 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10296 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051361 Essential Splice Site 423 1935 12 40
ENSDART00000124498 Essential Splice Site 423 452 13 14
ENSDART00000126873 Essential Splice Site 423 1935 13 41
ENSDART00000128949 Essential Splice Site 423 966 13 23
Genomic Location:
Chromosome 5 (position 33847663)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTSAAGGTCGGAAATGAGTTTGTGACCAAAGGACAGACTGTGCCACAG[G/A]TATGYAGTAACATTTTTAGCTGGTCCATCAGTTTTATTAGAAACTCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051361 Essential Splice Site 631 1935 16 40
ENSDART00000124498 None None 452 None 14
ENSDART00000126873 Essential Splice Site 631 1935 17 41
ENSDART00000128949 Essential Splice Site 631 966 17 23
Genomic Location:
Chromosome 5 (position 33848701)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTTTCTAGTTATTACATWATGTGTACCATTGTATWGTTATATAAAT[A/T]GAGACTGGTGGCGGAAAGAAGGGAGGCAAAAAGAAGGGTGGTTCCATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10296
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051361 Essential Splice Site 1453 1935 30 40
ENSDART00000124498 None None 452 None 14
ENSDART00000126873 Essential Splice Site 1453 1935 31 41
ENSDART00000128949 None None 966 None 23
Genomic Location:
Chromosome 5 (position 33852587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATGCTTTGGCTGCCAACCTTGACAAAAAGCAGAGGAACTTTGACAAG[G/T]TAAAATATGGAATTAAACTGTGATTTGATTTTTCTCTTTAAGAAAGTAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/11lfeppg