itgb5

Ensembl ID:
ENSDARG00000012942
ZFIN ID:
ZDB-GENE-030131-6022
Description:
integrin beta-5 [Source:RefSeq peptide;Acc:NP_001076305]
Human Orthologue:
ITGB5
Human Description:
integrin, beta 5 [Source:HGNC Symbol;Acc:6160]
Mouse Orthologue:
Itgb5
Mouse Description:
integrin beta 5 Gene [Source:MGI Symbol;Acc:MGI:96614]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11845 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11845
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080005 Nonsense 493 823 11 16
ENSDART00000101756 Nonsense 472 802 10 15
ENSDART00000131429   None 138 None 5
ENSDART00000138148 Nonsense 472 807 10 15

The following transcripts of ENSDARG00000012942 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23740570)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22896356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCGTCTAGAGGTTTCTGTGGATTACCGCTGTGATTGCCGCTGCACGTA[T/G]CACACAAAGCCGAACAGCAGCCGCTGCAACTCTGCTGGCACTTACAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link