itgb5

Ensembl ID:
ENSDARG00000012942
ZFIN ID:
ZDB-GENE-030131-6022
Description:
integrin beta-5 [Source:RefSeq peptide;Acc:NP_001076305]
Human Orthologue:
ITGB5
Human Description:
integrin, beta 5 [Source:HGNC Symbol;Acc:6160]
Mouse Orthologue:
Itgb5
Mouse Description:
integrin beta 5 Gene [Source:MGI Symbol;Acc:MGI:96614]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11845 Nonsense Available for shipment Available now
sa3709 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11845
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080005 Nonsense 493 823 11 16
ENSDART00000101756 Nonsense 472 802 10 15
ENSDART00000131429 None None 138 None 5
ENSDART00000138148 Nonsense 472 807 10 15

The following transcripts of ENSDARG00000012942 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 23740570)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCGTCTAGAGGTTTCTGTGGATTACCGCTGTGATTGCCGCTGCACGTA[T/G]CACACAAAGCCGAACAGCAGCCGCTGCAACTCTGCTGGCACTTACAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080005 Nonsense 622 823 12 16
ENSDART00000101756 Nonsense 601 802 11 15
ENSDART00000131429 None None 138 None 5
ENSDART00000138148 Nonsense 606 807 11 15

The following transcripts of ENSDARG00000012942 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 23769995)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATATTGGAGACAACTGTAATTGCTCGACGGAAAMGGCTTCCTGTGTGT[C/A]GGATGATGGCAAGATCTGTAGCGGCCGGGGCAGCTGTGTGTGCGGACGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l9pghjfp