tcea2

Ensembl ID:
ENSDARG00000012927
ZFIN ID:
ZDB-GENE-040426-985
Description:
transcription elongation factor A protein 2 [Source:RefSeq peptide;Acc:NP_957280]
Human Orthologue:
TCEA2
Human Description:
transcription elongation factor A (SII), 2 [Source:HGNC Symbol;Acc:11614]
Mouse Orthologue:
Tcea2
Mouse Description:
transcription elongation factor A (SII), 2 Gene [Source:MGI Symbol;Acc:MGI:107368]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6723 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10105 Nonsense Available for shipment Available now
sa37617 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014222 Essential Splice Site 175 301 6 10
Genomic Location:
Chromosome 23 (position 8833358)
KASP Assay ID:
554-5461.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGACGATTGGAGCAGACTGTGAACACATGGCGGCACAGATCGAGGATTA[T/C]ATCCTTCACATCGAAAGCTAGTGTTGTAGGCCTGGYTGTAATGTTGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10105
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014222 Nonsense 175 301 7 10
Genomic Location:
Chromosome 23 (position 8831402)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTCAAATAATACAACTGTACTTCCTTGACTGGTCCCCTTGATGCACA[T/A]ATTTACCAGGAGTTCAAATCCACCGACATGAAGTACAAGACCAGAYTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014222 Nonsense 187 301 7 10
Genomic Location:
Chromosome 23 (position 8831366)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTTGATGCACATATTTACCAGGAGTTCAAATCCACCGACATGAAGTA[C/A]AAGACCAGACTGAGGAGTCGTATTTCCAACCTAAAGGACCAAAAGAACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link