kal1a

Ensembl ID:
ENSDARG00000012896
ZFIN ID:
ZDB-GENE-000201-9
Description:
anosmin-1 [Source:RefSeq peptide;Acc:NP_571433]
Human Orthologue:
KAL1
Human Description:
Kallmann syndrome 1 sequence [Source:HGNC Symbol;Acc:6211]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1160 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa1160
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007522 Nonsense 228 652 5 14
Genomic Location (Zv9):
Chromosome 1 (position 31421264)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31234724
KASP Assay ID:
554-1070.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAGGTGGAATTACGGCATCCACCCCAGTGAAGATGGAGCCACTGAGT[G/A]GCAAGTGGTGGCACGGGTAAGTGTGAAATGTGTGAAATGTGTTTCACACC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link