npepl1

Ensembl ID:
ENSDARG00000012871
ZFIN ID:
ZDB-GENE-050417-177
Description:
probable aminopeptidase NPEPL1 [Source:RefSeq peptide;Acc:NP_001017688]
Human Orthologue:
NPEPL1
Human Description:
aminopeptidase-like 1 [Source:HGNC Symbol;Acc:16244]
Mouse Orthologue:
Npepl1
Mouse Description:
aminopeptidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:2448523]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8502 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024578 Nonsense 16 525 1 12
Genomic Location (Zv9):
Chromosome 6 (position 49693985)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49743666
KASP Assay ID:
2259-8129.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGATGGCGAACGTGCTGCTGGAGTTCAAGGCTTCAGCCGGGGACTCG[G/T]AGCCGCAAAACCGRCCGGTCCTGATCGTCGGTCAGCTCGCTAATCTRCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link