picalm

Ensembl ID:
ENSDARG00000012866
ZFIN IDs:
ZDB-GENE-040426-761, ZDB-GENE-040426-761
Description:
phosphatidylinositol-binding clathrin assembly protein [Source:RefSeq peptide;Acc:NP_957221]
Human Orthologue:
PICALM
Human Description:
phosphatidylinositol binding clathrin assembly protein [Source:HGNC Symbol;Acc:15514]
Mouse Orthologue:
Picalm
Mouse Description:
phosphatidylinositol binding clathrin assembly protein Gene [Source:MGI Symbol;Acc:MGI:2385902]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31786 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025227 Essential Splice Site 418 589 12 19
ENSDART00000034242 Essential Splice Site 418 589 12 19
ENSDART00000110968 Essential Splice Site 437 674 13 21
ENSDART00000123033 Essential Splice Site 418 497 13 17
Genomic Location (Zv9):
Chromosome 10 (position 29928892)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29301336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCTCCCTGCCTCTCTCCAGCGGCCTGCCTTTAGCCAACACATGGGGAG[G/A]TGAGTGGGTCACACCACAGGAACTCACAGAACTGGGCTAATATGCATATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link