tmprss4b

Ensembl ID:
ENSDARG00000012860
ZFIN ID:
ZDB-GENE-030131-5862
Description:
transmembrane protease, serine 4b [Source:RefSeq peptide;Acc:NP_001119849]
Human Orthologue:
TMPRSS4
Human Description:
transmembrane protease, serine 4 [Source:HGNC Symbol;Acc:11878]
Mouse Orthologue:
Tmprss4
Mouse Description:
transmembrane protease, serine 4 Gene [Source:MGI Symbol;Acc:MGI:2384877]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14822 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097754 Essential Splice Site 332 432 None 11
ENSDART00000126735 Essential Splice Site 235 339 None 12
ENSDART00000140207 None None 35 None 4
Genomic Location:
Chromosome 5 (position 39510143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAAAGACATGCTTGTGGTGACTGGATGGGGATTGCTAAAAGAGGGAGG[T/C]AAGRGAGATATTTATGAACACTTAATGGATTAACATCAACTCRGGTAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7uwsheja