asah2

Ensembl ID:
ENSDARG00000012829
ZFIN ID:
ZDB-GENE-041112-1
Description:
Neutral ceramidase [Source:UniProtKB/Swiss-Prot;Acc:Q5W7F1]
Human Orthologues:
ASAH2, ASAH2B, ASAH2C
Human Descriptions:
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2 [Source:HGNC Symbol;Acc:18860]
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2B [Source:HGNC Symbol;Acc:23456]
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2C [Source:HGNC Symbol;Acc:23457]
Mouse Orthologue:
Asah2
Mouse Description:
N-acylsphingosine amidohydrolase 2 Gene [Source:MGI Symbol;Acc:MGI:1859310]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2672 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027793 Nonsense 589 743 17 20
ENSDART00000146650 Nonsense 589 743 18 21
Genomic Location:
Chromosome 12 (position 6820368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGAACAAATCTCCCACAGGGGACAATAGGAGAKCTGCCAAAGGGWCCC[G/T]AACCCCCTTTCTTTGATGAAGACAAACTTTTTAATCAAGTAAGAGACCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0u8fxg2u