mettl3

Ensembl ID:
ENSDARG00000012827
ZFIN ID:
ZDB-GENE-030131-9498
Description:
N6-adenosine-methyltransferase 70 kDa subunit [Source:RefSeq peptide;Acc:NP_997945]
Human Orthologue:
METTL3
Human Description:
methyltransferase like 3 [Source:HGNC Symbol;Acc:17563]
Mouse Orthologue:
Mettl3
Mouse Description:
methyltransferase like 3 Gene [Source:MGI Symbol;Acc:MGI:1927165]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20914 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1579 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019699 Essential Splice Site 246 584 3 11
Genomic Location:
Chromosome 7 (position 23052833)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAGTCTACTGAGCCAGCAATCCACTAAGGAACAGCAAAGCAAAAAGG[T/C]ATAATAATGAAGCAAAACAGCATGCTAAAGCCACTGTGATTTAAATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019699 Nonsense 533 584 10 11
Genomic Location:
Chromosome 7 (position 23045365)
KASP Assay ID:
554-1522.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAACCAGATGAGATCTATGGAATGATTGAGCGCCTGTCTCCAGGCACA[C/T]GAAAGATTGAATTGTTTGGCAGGCCACACAATGTACAACCTAACTGGTGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7500cnf4