itga3b

Ensembl ID:
ENSDARG00000012824
ZFIN ID:
ZDB-GENE-050411-55
Description:
integrin, alpha 3b [Source:RefSeq peptide;Acc:NP_001177238]
Human Orthologues:
ITGA6, ITGA7
Human Descriptions:
integrin, alpha 6 [Source:HGNC Symbol;Acc:6142]
integrin, alpha 7 [Source:HGNC Symbol;Acc:6143]
Mouse Orthologues:
Itga6, Itga7
Mouse Descriptions:
integrin alpha 6 Gene [Source:MGI Symbol;Acc:MGI:96605]
integrin alpha 7 Gene [Source:MGI Symbol;Acc:MGI:102700]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22024 Nonsense Available for shipment Available now
sa35203 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31854 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105884 Nonsense 546 1041 12 26
Genomic Location (Zv9):
Chromosome 12 (position 6175251)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5576074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACGTTTACAGGCCTTCTGTCTTTCTCTGCTTCTTCCTGTCAAGAGCTG[G/T]AGCTCAGTGTTAATGTGAGAGTCTATGATCACACTGTACACATTCTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105884 Essential Splice Site 737 1041 18 26
Genomic Location (Zv9):
Chromosome 12 (position 6183532)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5567793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAATGCGCTATATGGTCACTGACAGTGATGATGTTTGTTTGTCTTCA[G/A]TATTAGTGAACAGGCGGATCTGTTTCCTGTTCTTGTCACCCTCAATGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105884 Essential Splice Site 763 1041 18 26
Genomic Location (Zv9):
Chromosome 12 (position 6183612)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5567713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTGTCACCCTCAATGTGAAGAACACGATCCTCACTACATTTTCTTTG[T/C]ACGTACTTTGATGTTATTAACAATAAAACAATCTGTGTGCATTTACATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link