DLGAP4 (1 of 2)

Ensembl ID:
ENSDARG00000012823
Description:
discs, large (Drosophila) homolog-associated protein 4 [Source:HGNC Symbol;Acc:24476]
Human Orthologue:
DLGAP4
Human Description:
discs, large (Drosophila) homolog-associated protein 4 [Source:HGNC Symbol;Acc:24476]
Mouse Orthologue:
Dlgap4
Mouse Description:
discs, large homolog-associated protein 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2138865]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1639 Nonsense F2 line generated During 2017
sa7580 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1639
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007972 Nonsense 179 1081 2 11
Genomic Location (Zv9):
Chromosome 6 (position 1787115)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1739408
KASP Assay ID:
554-1579.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCACGTTACAGTTTCAYCGCAGCACYGCAGTCACAACGACRAAACAG[C/T]AGCAACARCAGCGCACAGACAGCCCGGGGAAAATCCGCTACTTAGTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7580
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007972 Missense 1081 1081 11 11
Genomic Location (Zv9):
Chromosome 6 (position 1743746)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1696039
KASP Assay ID:
554-4209.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGAGCGCAGACAGCATCGAAATCTACGTCCCTGAAGCCCAGACGCGAC[T/A]CTGAGGAAAAAACAGAGACCGCCAACCACTGCTCAAGGGCTCCGGCATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link