nop56

Ensembl ID:
ENSDARG00000012820
ZFIN ID:
ZDB-GENE-040109-1
Description:
nucleolar protein 56 [Source:RefSeq peptide;Acc:NP_957511]
Human Orthologues:
AC027288.1, NOP56
Human Description:
NOP56 ribonucleoprotein homolog (yeast) [Source:HGNC Symbol;Acc:15911]
Mouse Orthologue:
Nop56
Mouse Description:
NOP56 ribonucleoprotein homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914384]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12582 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062681   None 110 4 6
ENSDART00000062687 Nonsense 416 493 10 13
ENSDART00000102433   None 142 9 11
ENSDART00000114524 Nonsense 416 548 10 12
ENSDART00000127406 Nonsense 419 538 9 14

The following transcripts of ENSDARG00000012820 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 10386634)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11869997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACCAGGTAGAAGAACGTCTGGCCTTCTATGAGACAGGGGAGGCTCCA[C/T]GAAAGAATCTGGATGTCATGAAAGAAGCTGTTGCACAGGTGAGCCCTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link