tmem161a

Ensembl ID:
ENSDARG00000012790
ZFIN ID:
ZDB-GENE-041111-267
Description:
Transmembrane protein 161A [Source:UniProtKB/Swiss-Prot;Acc:Q0V947]
Human Orthologue:
TMEM161A
Human Description:
transmembrane protein 161A [Source:HGNC Symbol;Acc:26020]
Mouse Orthologue:
Tmem161a
Mouse Description:
transmembrane protein 161A Gene [Source:MGI Symbol;Acc:MGI:2384577]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1279 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027605 Nonsense 244 512 8 12
ENSDART00000083879 Nonsense 227 495 8 12
Genomic Location:
Chromosome 22 (position 18460733)
KASP Assay ID:
554-1194.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACATCTAATATTTAAATATTTTAACAGAGTTCCCTTCACCAAACTGT[C/A]AGTGAAGCTGGGCCTGGCTGTAATTTGTGCCTTTATTGGAGCTCTTCTTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3ps5zzv2