ENSDARG00000012764

Ensembl ID:
ENSDARG00000012764
Human Orthologues:
HNF4A, HNF4G
Human Descriptions:
hepatocyte nuclear factor 4, alpha [Source:HGNC Symbol;Acc:5024]
hepatocyte nuclear factor 4, gamma [Source:HGNC Symbol;Acc:5026]
Mouse Orthologues:
Hnf4a, Hnf4g
Mouse Descriptions:
hepatic nuclear factor 4, alpha Gene [Source:MGI Symbol;Acc:MGI:109128]
hepatocyte nuclear factor 4, gamma Gene [Source:MGI Symbol;Acc:MGI:1353604]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21135 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024443 Nonsense 56 463 2 19
Genomic Location:
Chromosome 7 (position 70190827)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCACTAATGCCAGGTCACGCGTCTGCATCAGTCCCCGTGGTGGTCCCA[C/T]AGCAGAGCAGCATGAGTCTCTGTGCCATCTGCGCAGACCGAGCCACTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • C-reactive protein: Genome-wide association and population genetic analysis of C-reactive protein in African American and Hispanic American women. (View Study)
  • C-reactive protein: Meta-analysis of genome-wide association studies in >80 000 subjects identifies multiple loci for C-reactive protein levels. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
  • Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
  • Type 2 diabetes: Genome-wide association study in individuals of South Asian ancestry identifies six new type 2 diabetes susceptibility loci. (View Study)
  • Type 2 diabetes: Meta-analysis of genome-wide association studies identifies eight new loci for type 2 diabetes in east Asians. (View Study)
  • Ulcerative colitis: Genome-wide association study of ulcerative colitis identifies three new susceptibility loci, including the HNF4A region. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fduyuhle