arl13b

Ensembl ID:
ENSDARG00000012763
ZFIN ID:
ZDB-GENE-021217-3
Description:
ADP-ribosylation factor-like protein 13B [Source:UniProtKB/Swiss-Prot;Acc:Q8JHI3]
Human Orthologue:
ARL13B
Human Description:
ADP-ribosylation factor-like 13B [Source:HGNC Symbol;Acc:25419]
Mouse Orthologue:
Arl13b
Mouse Description:
ADP-ribosylation factor-like 13B Gene [Source:MGI Symbol;Acc:MGI:1915396]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25614 Essential Splice Site Mutation detected in F1 DNA During 2015
sa17422 Nonsense Available for shipment Available now
sa25615 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa25614
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102184 Essential Splice Site 162 407 4 10
ENSDART00000122316 Essential Splice Site 162 261 4 5
Genomic Location:
Chromosome 1 (position 33315606)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTCATTGGAGAAGCTAGTCAACGAAAATAAATGCCTTTGCCAGATTG[T/A]AAGTTAATATTTCATCACAATTTATTATAACCGGAGTCTGGTTTGATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102184   None 407 None 10
ENSDART00000122316 Nonsense 249 261 5 5
Genomic Location:
Chromosome 1 (position 33316043)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTACWAAACTKCAGATTGTTGCTGCTTAAMGCCTGGTTTATRCTCTA[C/A]GYGCCAGCTWGTTYGCTTGAGTGCGTGCAGCGAATGTGACGTCATCRCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102184 Nonsense 270 407 7 10
ENSDART00000122316   None 261 None 5
Genomic Location:
Chromosome 1 (position 33319787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGAACTCATTAGAATGCAAATACTCACTTTATATAAAAATTCCAGAAC[C/T]AAGACAGACTAAACAGAGAAAAAGAGATGCAAAGACAGAGGGAAAATGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2rh6zbbo