
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
arl13b
- Ensembl ID:
- ENSDARG00000012763
- ZFIN ID:
- ZDB-GENE-021217-3
- Description:
- ADP-ribosylation factor-like protein 13B [Source:UniProtKB/Swiss-Prot;Acc:Q8JHI3]
- Human Orthologue:
- ARL13B
- Human Description:
- ADP-ribosylation factor-like 13B [Source:HGNC Symbol;Acc:25419]
- Mouse Orthologue:
- Arl13b
- Mouse Description:
- ADP-ribosylation factor-like 13B Gene [Source:MGI Symbol;Acc:MGI:1915396]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa25614 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa17422 | Nonsense | Available for shipment | Available now |
sa25615 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa25614
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102184 | Essential Splice Site | 162 | 407 | 4 | 10 |
ENSDART00000122316 | Essential Splice Site | 162 | 261 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 1 (position 33315606)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 32950357 GRCz11 1 33682925 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTGTCATTGGAGAAGCTAGTCAACGAAAATAAATGCCTTTGCCAGATTG[T/A]AAGTTAATATTTCATCACAATTTATTATAACCGGAGTCTGGTTTGATAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17422
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102184 | None | 407 | None | 10 | |
ENSDART00000122316 | Nonsense | 249 | 261 | 5 | 5 |
- Genomic Location (Zv9):
- Chromosome 1 (position 33316043)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 32950794 GRCz11 1 33683362 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCTTACWAAACTKCAGATTGTTGCTGCTTAAMGCCTGGTTTATRCTCTA[C/A]GYGCCAGCTWGTTYGCTTGAGTGCGTGCAGCGAATGTGACGTCATCRCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25615
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102184 | Nonsense | 270 | 407 | 7 | 10 |
ENSDART00000122316 | None | 261 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 1 (position 33319787)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 32954538 GRCz11 1 33687106 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCGAACTCATTAGAATGCAAATACTCACTTTATATAAAAATTCCAGAAC[C/T]AAGACAGACTAAACAGAGAAAAAGAGATGCAAAGACAGAGGGAAAATGGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: