tmem57b

Ensembl ID:
ENSDARG00000012741
ZFIN ID:
ZDB-GENE-040426-1188
Description:
macoilin [Source:RefSeq peptide;Acc:NP_956757]
Human Orthologue:
TMEM57
Human Description:
transmembrane protein 57 [Source:HGNC Symbol;Acc:25572]
Mouse Orthologue:
Tmem57
Mouse Description:
transmembrane protein 57 Gene [Source:MGI Symbol;Acc:MGI:1913396]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22376 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa6330 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019113 Essential Splice Site 35 214 None 7
ENSDART00000074567 Missense 49 699 2 11
Genomic Location:
Chromosome 13 (position 46155633)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTTTCTGGTGGTCTGGGCGCTGGTGCTGCTGGCAGACTTTGTGTTGG[A/T]GTTTCGCTTCGAGTACCTCTGGCCTTTCTGGCTCTTTATTCGCAGTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019113 Nonsense 76 214 4 7
ENSDART00000074567 Nonsense 91 699 3 11
Genomic Location:
Chromosome 13 (position 46160819)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTCTCAGTGTTTTTTGTGTGTGTGKCATTCACATCAGATATTATATG[T/A]CTGCTGTTCATCCCAGTACAGTGGCTGTTCTTTGCAGCCAGCACATACGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yh46dvle