si:ch211-255l14.7

Ensembl ID:
ENSDARG00000012738
ZFIN ID:
ZDB-GENE-060503-319
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1MT95]
Human Orthologue:
ZCCHC14
Human Description:
zinc finger, CCHC domain containing 14 [Source:HGNC Symbol;Acc:24134]
Mouse Orthologue:
Zcchc14
Mouse Description:
zinc finger, CCHC domain containing 14 Gene [Source:MGI Symbol;Acc:MGI:2159407]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38022 Nonsense Mutation detected in F1 DNA During 2017
sa6798 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005778 Nonsense 251 754 8 12
ENSDART00000144728 Nonsense 273 776 8 12
Genomic Location (Zv9):
Chromosome 25 (position 13368046)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 12494171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTCACTTACAGTTCCTCGCGCTCACAGAAGAGGATCTCAACAAATA[C/A]GACCTCACTCAGGGGGCCAAGAAGAAACTAAAGACTCAGCTGGAGCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6798
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005778 Nonsense 724 754 11 12
ENSDART00000144728 Nonsense 746 776 11 12
Genomic Location (Zv9):
Chromosome 25 (position 13376968)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 12485249
KASP Assay ID:
554-4623.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACAGGGAATGTGTCTTGCTATAACTGTGGGCTGAGTGGGCATCATGCA[C/T]AAGACTGYAAGCAGCCAGCMATGGAYTCTGCACAACAAGGTAACAASTAR
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link