LOC798204

Ensembl ID:
ENSDARG00000012726
Human Orthologue:
FAM26E
Human Description:
family with sequence similarity 26, member E [Source:HGNC Symbol;Acc:21568]
Mouse Orthologue:
Fam26e
Mouse Description:
family with sequence similarity 26, member E Gene [Source:MGI Symbol;Acc:MGI:2143897]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16915 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16915
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023995 Nonsense 106 308 1 2
Genomic Location:
Chromosome 16 (position 34522861)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCGARGAAACTTTGTGGGATGCTTGTCAGTGTTTATAAAGGTGTTGTM[T/A]GGAGCCTGCGTTGCCCCTGTCATGTGRCTTACTGTAGCCCTGTTAAATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vjpk1bfy