agl

Ensembl ID:
ENSDARG00000012709
ZFIN ID:
ZDB-GENE-071004-6
Description:
amylo-1, 6-glucosidase, 4-alpha-glucanotransferase [Source:RefSeq peptide;Acc:NP_001166124]
Human Orthologue:
AGL
Human Description:
amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase [Source:HGNC Symbol;Acc:321]
Mouse Orthologue:
Agl
Mouse Description:
amylo-1,6-glucosidase, 4-alpha-glucanotransferase Gene [Source:MGI Symbol;Acc:MGI:1924809]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7491 Missense Mutation detected in F1 DNA During 2014
sa10885 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7491
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007766 Missense 182 1539 4 33
Genomic Location:
Chromosome 2 (position 20248312)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGCTGGGTGAGTCTCGCTCCTGTTACTCTCTGGCWGATCAGCTGGAGC[T/C]CAACCCAGACTTCTCTCCTTCGGGACAAACGTACACCTGGACAGATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007766 Nonsense 1229 1539 26 33
Genomic Location:
Chromosome 2 (position 20287488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCGCCACATRCAGGGTATWGAGTTCAGAGAGAGSAATGCCGGACCA[C/T]AGATTGAYCGYAACATGAGAGAYGAAGGTACAGTAAAGCCTTTTTAATAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1j39ixda