si:ch211-55i2.1

Ensembl ID:
ENSDARG00000012699
ZFIN ID:
ZDB-GENE-091204-306
Human Orthologue:
BBX
Human Description:
bobby sox homolog (Drosophila) [Source:HGNC Symbol;Acc:14422]
Mouse Orthologue:
Bbx
Mouse Description:
bobby sox homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1917758]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8933 Essential Splice Site Mutation detected in F1 DNA During 2017
hu7857 Nonsense Available for shipment Available now
sa6137 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018788 Essential Splice Site 139 906 None 24
ENSDART00000137008   None 129 None 2
ENSDART00000137964   139 139 None 3
ENSDART00000139994   None 317 None 4
ENSDART00000142476 Essential Splice Site 139 229 None 6
Genomic Location (Zv9):
Chromosome 10 (position 29184078)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28615672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGTAYTGGACCCCAAAGAAAAGCAGAAATACACAGACATGGCCAAGGAGG[T/A]AARAACTAACCAACACACACGACTCAATTGAAYGATTAGCTAACATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7857
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018788 Nonsense 313 906 9 24
ENSDART00000137008   None 129 None 2
ENSDART00000137964   None 139 None 3
ENSDART00000139994   None 317 None 4
ENSDART00000142476   None 229 None 6
Genomic Location (Zv9):
Chromosome 10 (position 29174558)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28606152
KASP Assay ID:
554-2411.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCACACTGGGAAATCAGCCCTTTTCCAGCTGGCTGAGGTGAGATTACCT[A/T]AAAAACTTGTCTGTCAGACCCATAAWACCCTACTTAGSSNCKRRRACGTYT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018788 Essential Splice Site 381 906 10 24
ENSDART00000137008   None 129 None 2
ENSDART00000137964   None 139 None 3
ENSDART00000139994   None 317 None 4
ENSDART00000142476   None 229 None 6
Genomic Location (Zv9):
Chromosome 10 (position 29172982)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28604576
KASP Assay ID:
554-3767.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTCTTGTGTTGAAAAGGCATCTYTGGATACCTTTCTTTTCTTTGGATA[T/A]AAAGTAAGCAACTNNNNTGTTCAGGTCTATAACATTACAAATGTCTGCTS
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link