nkx1.2lb

Ensembl ID:
ENSDARG00000012697
ZFIN ID:
ZDB-GENE-040615-2
Description:
NK1 transcription factor related 2-like,b [Source:RefSeq peptide;Acc:NP_998713]
Human Orthologue:
NKX1-1
Human Description:
NK1 homeobox 1 [Source:HGNC Symbol;Acc:24975]
Mouse Orthologues:
Nkx1-1, Nkx1-2
Mouse Descriptions:
NK1 transcription factor related, locus 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109346]
NK1 transcription factor related, locus 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104806]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2737 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa2737
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002085 Nonsense 212 373 2 2
ENSDART00000137414 Nonsense 185 346 2 2
Genomic Location (Zv9):
Chromosome 14 (position 18967545)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14761998
KASP Assay ID:
554-2445.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGACAGCAGACACAGCAGTCCTCGTCAAACGGACAGAATCACCAGGTG[A/T]AACCCAAACGGAAGCGCTCCGGGTCAGACTCAAAGTCTGGCAAACCCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link