tfap2b

Ensembl ID:
ENSDARG00000012667
ZFIN ID:
ZDB-GENE-050417-394
Description:
transcription factor AP-2-beta isoform 1 [Source:RefSeq peptide;Acc:NP_001017847]
Human Orthologue:
TFAP2B
Human Description:
transcription factor AP-2 beta (activating enhancer binding protein 2 beta) [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Tcfap2b
Mouse Description:
transcription factor AP-2 beta Gene [Source:MGI Symbol;Acc:MGI:104672]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10090 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10090
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013003 Essential Splice Site 182 439 4 7
ENSDART00000024898 None None 266 None 4
ENSDART00000060539 Essential Splice Site 189 446 4 7
ENSDART00000132105 Essential Splice Site 189 446 6 9
ENSDART00000135380 Essential Splice Site 189 261 4 4
ENSDART00000138860 None None 181 None 3
Genomic Location:
Chromosome 20 (position 48380760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAYCTATCGGACGTGGCTCAATTTTATGTTTTTGTTTTTCCACGCACA[G/A]TTCCAGTTCCTCACAAAAGCGTCGCTTCTCTGATGATGAACAAAGACGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hmlutagn