si:ch211-199m3.9

Ensembl ID:
ENSDARG00000012656
ZFIN ID:
ZDB-GENE-041014-328
Description:
cyclic AMP-dependent transcription factor ATF-6 alpha [Source:RefSeq peptide;Acc:NP_001103989]
Human Orthologue:
ATF6
Human Description:
activating transcription factor 6 [Source:HGNC Symbol;Acc:791]
Mouse Orthologue:
Atf6
Mouse Description:
activating transcription factor 6 Gene [Source:MGI Symbol;Acc:MGI:1926157]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23750 Nonsense Available for shipment Available now
sa1154 Nonsense Available for shipment Available now
sa37085 Nonsense Available for shipment Available now
sa43484 Nonsense Mutation detected in F1 DNA During 2017
sa37084 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007700 Nonsense 177 653 6 16
Genomic Location (Zv9):
Chromosome 20 (position 33884530)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33957043
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGCCAAACCTCTCCAACCAGCAAAAAGACCCATCCAGGTGTGCCCC[A/T]AGGTTTCCATTCAGCCTAAACCAATCATTACAGCTGTTCCCATCTCCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1154
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007700 Nonsense 428 653 11 16
Genomic Location (Zv9):
Chromosome 20 (position 33862048)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33934561
KASP Assay ID:
554-1065.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGTTAAACTTTCCTGGCTTTAACATGACTTTTGTCTTTCTCATAGGT[T/A]GGAGGAGGGGGTTTCAGAGCAGAAGGCATTGATGGTGGTCAAGGATCCTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa37085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007700 Nonsense 446 653 11 16
Genomic Location (Zv9):
Chromosome 20 (position 33861993)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33934506
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGGGTTTCAGAGCAGAAGGCATTGATGGTGGTCAAGGATCCTCTGTA[T/A]TTCAGAACTCCACCCCCCTGCCAGCCACCTGTCAACAGGACCAAGTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43484
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007700 Nonsense 503 653 13 16
Genomic Location (Zv9):
Chromosome 20 (position 33856622)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33929135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACGTGACATTTTTATTTTCCTCTGTCCAACAGAAAGCGTCAAGTAAA[C/T]AAGCTGACGTACCACAGATAATGTCACAGATCCAGTACACAGACTCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007700 Essential Splice Site 521 653 13 16
Genomic Location (Zv9):
Chromosome 20 (position 33856565)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33929078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTACCACAGATAATGTCACAGATCCAGTACACAGACTCCTCTGAAAAG[T/C]AAGTTTTCTTCGAGAAGCTATGTTTTACCTTCATTTTACATGGTGTAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link