si:ch211-266d19.4

Ensembl ID:
ENSDARG00000012642
ZFIN ID:
ZDB-GENE-091204-74

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44071 Nonsense Mutation detected in F1 DNA During 2017
sa24432 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44071
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106569 Nonsense 797 1055 8 12
ENSDART00000132530 Nonsense 797 1025 10 11
Genomic Location (Zv9):
Chromosome 24 (position 2365310)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 2335308
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTCGCTGGAGGAGGAACCTGATCTCACACCAGAGCACCCACCCGGGA[C/T]AAAACCCTCTCCAGTGTTCAATGTGCGATCAAACGTTCATCTCTGAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106569 Nonsense 1001 1055 9 12
ENSDART00000132530 Nonsense 1001 1025 11 11
Genomic Location (Zv9):
Chromosome 24 (position 2368234)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 2338232
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCGCATCTGTCTGTTCATCTGCGCAGTCACACGGGGGAAAAGCCCTA[C/A]CAGTGTCCCATATGCCTCAAGTTCTTCGCCCATTCGTCCTCCATGAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link