
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cideb
- Ensembl ID:
- ENSDARG00000012640
- ZFIN ID:
- ZDB-GENE-080514-2
- Description:
- Cideb protein [Source:UniProtKB/TrEMBL;Acc:Q502E9]
- Human Orthologue:
- CIDEB
- Human Description:
- cell death-inducing DFFA-like effector b [Source:HGNC Symbol;Acc:1977]
- Mouse Orthologue:
- Cideb
- Mouse Description:
- cell death-inducing DNA fragmentation factor, alpha subunit-like effector B Gene [Source:MGI Symbol;
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18543 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa18543
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000013538 | Essential Splice Site | 86 | 246 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 25186325)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 23748077 GRCz11 7 24019234 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- WTGATGTAAATKTGTGGCATGTTTGACAGAATACTGTAACTCTTACCTCA[G/A]GCAGGCCAGGCTCTGCTGATTTCTAAMATGCTGACCCTGGTGTGTGAGGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: