cideb

Ensembl ID:
ENSDARG00000012640
ZFIN ID:
ZDB-GENE-080514-2
Description:
Cideb protein [Source:UniProtKB/TrEMBL;Acc:Q502E9]
Human Orthologue:
CIDEB
Human Description:
cell death-inducing DFFA-like effector b [Source:HGNC Symbol;Acc:1977]
Mouse Orthologue:
Cideb
Mouse Description:
cell death-inducing DNA fragmentation factor, alpha subunit-like effector B Gene [Source:MGI Symbol;

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18543 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18543
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013538 Essential Splice Site 86 246 4 6
Genomic Location:
Chromosome 7 (position 25186325)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WTGATGTAAATKTGTGGCATGTTTGACAGAATACTGTAACTCTTACCTCA[G/A]GCAGGCCAGGCTCTGCTGATTTCTAAMATGCTGACCCTGGTGTGTGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/043oeqe2