cdc34b

Ensembl ID:
ENSDARG00000012627
ZFIN ID:
ZDB-GENE-040718-439
Description:
ubiquitin-conjugating enzyme [Source:RefSeq peptide;Acc:NP_001002688]
Human Orthologue:
CDC34
Human Description:
cell division cycle 34 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:1734]
Mouse Orthologues:
Cdc34, Cdc34-ps
Mouse Descriptions:
cell division cycle 34 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:102657]
cell division cycle 34 homolog, pseudogene (S. cerevisiae) Pseudogene [Source:MGI Symbol;Acc:MGI:185

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19887 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017970 Nonsense 164 239 4 5
ENSDART00000143471 Nonsense 150 225 4 5
Genomic Location:
Chromosome 2 (position 49574370)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTCATGTACCGCAAATGGAGAGACAGTAAAGGAAAAGACCGGGAATA[T/A]GCAGAAATCATTAGGTAAAATACTGAAAACAAACAGAGCTTCAGTTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rdhqeb4x