hpx

Ensembl ID:
ENSDARG00000012609
ZFIN ID:
ZDB-GENE-030131-5773
Description:
Hemopexin [Source:UniProtKB/Swiss-Prot;Acc:Q6PHG2]
Human Orthologue:
HPX
Human Description:
hemopexin [Source:HGNC Symbol;Acc:5171]
Mouse Orthologue:
Hpx
Mouse Description:
hemopexin Gene [Source:MGI Symbol;Acc:MGI:105112]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30920 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41460 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31729 Nonsense Available for shipment Available now
sa1444 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa30920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020637 Essential Splice Site None 447 1 12
ENSDART00000121506   None 447 None 10
ENSDART00000020637 Essential Splice Site None 447 1 12
ENSDART00000121506   None 447 None 10

The following transcripts of ENSDARG00000012609 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33890284)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33046230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCGAATCAGCATCTCGTTTTCTGTCAGCATGGCAACAGATCCACGCGT[G/A]TCCACAGTGCAGCTCCACGGCACGGCGAGTTTCGAGTCCGGTGAGGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41460
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020637 Essential Splice Site None 447 1 12
ENSDART00000121506   None 447 None 10
ENSDART00000020637 Essential Splice Site None 447 1 12
ENSDART00000121506   None 447 None 10

The following transcripts of ENSDARG00000012609 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33890284)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33046230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCGAATCAGCATCTCGTTTTCTGTCAGCATGGCAACAGATCCACGCGT[G/A]TCCACAGTGCAGCTCCACGGCACGGCGAGTTTCGAGTCCGGTGAGGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020637 Nonsense 52 447 5 12
ENSDART00000121506 Nonsense 52 447 3 10

The following transcripts of ENSDARG00000012609 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33879954)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33035900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAGGACACAAGCATGAGTTGCACCACGGTGCTCAGCTTGACCGCTGT[A/T]AAGGAATAGAGTTTGATGCAGTCGCCGTGAACGAGGAGGGAGTTCCTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1444
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020637 Essential Splice Site 247 447 8 12
ENSDART00000121506 Essential Splice Site 247 447 6 10

The following transcripts of ENSDARG00000012609 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33877004)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33032950
KASP Assay ID:
554-1370.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATATCCAAAAGAGGCCCGTGATTACTTCATGAGGTGCCCTCACTTTGG[T/C]AAGTGTATWAATGAGCATGTTAGKAAAGGKGGTAGAGATGGAGCAAGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link