polr2b

Ensembl ID:
ENSDARG00000012592
ZFIN ID:
ZDB-GENE-041008-1
Description:
DNA-directed RNA polymerase II subunit RPB2 [Source:RefSeq peptide;Acc:NP_001019632]
Human Orthologue:
POLR2B
Human Description:
polymerase (RNA) II (DNA directed) polypeptide B, 140kDa [Source:HGNC Symbol;Acc:9188]
Mouse Orthologue:
Polr2b
Mouse Description:
polymerase (RNA) II (DNA directed) polypeptide B Gene [Source:MGI Symbol;Acc:MGI:2388280]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12802 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12802
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041408 Nonsense 290 562 7 12
ENSDART00000124865 Nonsense 290 1117 7 25
ENSDART00000128452 Nonsense 290 366 7 8

The following transcripts of ENSDARG00000012592 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 53579122)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 51684633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCGCTTTAGGAWTYGTGTCTGACAGAGACATTCTGGAGCACATCATCTA[T/A]GACTTCGATGATCCGGAGAKGATGGAAATGGTATGTCACATGAGCGCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Age-related macular degeneration: Genome-wide association study identifies two susceptibility loci for exudative age-related macular degeneration in the Japanese population. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link