pdcd10b

Ensembl ID:
ENSDARG00000012591
ZFIN ID:
ZDB-GENE-040426-2607
Description:
Programmed cell death protein 10-B [Source:UniProtKB/Swiss-Prot;Acc:Q6NWL1]
Human Orthologue:
PDCD10
Human Description:
programmed cell death 10 [Source:HGNC Symbol;Acc:8761]
Mouse Orthologue:
Pdcd10
Mouse Description:
programmed cell death 10 Gene [Source:MGI Symbol;Acc:MGI:1928396]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31287 Nonsense Available for shipment Available now
sa15060 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019063 Nonsense 99 210 5 8
Genomic Location (Zv9):
Chromosome 2 (position 36445188)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36741898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCTGTTGTTTTACAGAGTACATGATTAAGAGACCTGAACAGGAGTTC[C/T]AGGACCTGAATGAGAAAGCACGAGCTCTAAAACATATCCTGAGTAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15060
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019063 Nonsense 150 210 6 8
Genomic Location (Zv9):
Chromosome 2 (position 36448235)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36744945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGCTATWAAGGAGCTGCTGGACACAGTCAACAATGTTTTTAGGAAGTA[T/G]CAGTACCAGAATCGCAGGGTTGGTATTTCTTGTTTYTCAGATACAYAWTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link