ptdss1

Ensembl ID:
ENSDARG00000012588
ZFIN ID:
ZDB-GENE-040426-837
Description:
phosphatidylserine synthase 1 [Source:RefSeq peptide;Acc:NP_957250]
Human Orthologue:
PTDSS1
Human Description:
phosphatidylserine synthase 1 [Source:HGNC Symbol;Acc:9587]
Mouse Orthologue:
Ptdss1
Mouse Description:
phosphatidylserine synthase 1 Gene [Source:MGI Symbol;Acc:MGI:1276575]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11462 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010792 Nonsense 347 465 9 13
Genomic Location (Zv9):
Chromosome 16 (position 56822824)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53405489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GNNNNTGTGTGTTGCAGACAGTATTATGCRTATCTAACAGACACTCAGTG[T/A]AAGCGTGTCGGGACTCAGTGCTGGGTGTTTGGGTGAGTTTCAGCATCTTY
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link