fmnl2a

Ensembl ID:
ENSDARG00000012586
ZFIN ID:
ZDB-GENE-081105-70
Description:
Novel protein similar to H.sapiens FMNL2, formin-like 2 (FMNL2) [Source:UniProtKB/TrEMBL;Acc:B0V1Q0]
Human Orthologue:
FMNL2
Human Description:
formin-like 2 [Source:HGNC Symbol;Acc:18267]
Mouse Orthologue:
Fmnl2
Mouse Description:
formin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1918659]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7172 Nonsense Mutation detected in F1 DNA During 2014
sa6108 Nonsense Mutation detected in F1 DNA During 2014
sa21427 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016814 Nonsense 15 1077 1 26
ENSDART00000133090 None None 476 None 11
ENSDART00000138015 None None 468 None 11
ENSDART00000147920 None None 353 None 8
Genomic Location:
Chromosome 9 (position 4862643)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGAGAGATGGGGAACGCGGGGAGTATGAACCAACACACTGACCCCAGA[G/T]GACACCACATGCCCCTCAAACTGCCCATGCCCGAGCCAGCGGAGCTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016814 Nonsense 367 1077 12 26
ENSDART00000133090 None None 476 None 11
ENSDART00000138015 None None 468 None 11
ENSDART00000147920 Nonsense 169 353 6 8
Genomic Location:
Chromosome 9 (position 4773845)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRCTCTCSCTATAGAAGCTGAAGCACACYGAGAGCGATAAGCTGCATGTG[C/T]AGATTCAAGCATACCTGGATAACGTGTTTGATGTCGGAGCTCTGTTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016814 Nonsense 715 1077 17 26
ENSDART00000133090 Nonsense 106 476 2 11
ENSDART00000138015 Nonsense 106 468 2 11
ENSDART00000147920 None None 353 None 8
Genomic Location:
Chromosome 9 (position 4759425)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGGCCATCACCCTTAGGAAAGTGGGCAAGACATCAGAGGAGATCTGC[A/T]GAGGCATTCAATTGTAATTCACAGCTGACACACTATAGATATTTCACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rwgkxxbd