polr3f

Ensembl ID:
ENSDARG00000012572
ZFIN ID:
ZDB-GENE-040426-972
Description:
DNA-directed RNA polymerase III subunit RPC6 [Source:RefSeq peptide;Acc:NP_957481]
Human Orthologue:
POLR3F
Human Description:
polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa [Source:HGNC Symbol;Acc:15763]
Mouse Orthologue:
Polr3f
Mouse Description:
polymerase (RNA) III (DNA directed) polypeptide F Gene [Source:MGI Symbol;Acc:MGI:1924086]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24185 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015512 Nonsense 237 314 8 9
Genomic Location (Zv9):
Chromosome 22 (position 25510903)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25010809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTCCTGTGTGCAGGTGGATCTGTCCATGGAGGACATCGAGACCATCT[T/G]AAACACACTGATCTTTGATGGAAAAGTGGAAATGACCATAATTGCTGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link