ak5

Ensembl ID:
ENSDARG00000012555
ZFIN ID:
ZDB-GENE-030131-8256
Description:
adenylate kinase isoenzyme 5 [Source:RefSeq peptide;Acc:NP_001093554]
Human Orthologue:
AK5
Human Description:
adenylate kinase 5 [Source:HGNC Symbol;Acc:365]
Mouse Orthologue:
Ak5
Mouse Description:
adenylate kinase 5 Gene [Source:MGI Symbol;Acc:MGI:2677491]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18317 Essential Splice Site Available for shipment Available now
sa2067 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa18317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Essential Splice Site 369 563 9 14
Genomic Location:
Chromosome 2 (position 8654363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAGGCTGATGAAGAGGYGGCTGAATATGCAGAGGCGATTGGAGAAAG[T/C]GAGTGCAGTCTTTTNCAATGTATCTTCWTGCACTGTATTTGTGTGTGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2067
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Nonsense 427 563 11 14
Genomic Location:
Chromosome 2 (position 8647528)
KASP Assay ID:
554-3371.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCCTGTGCAGTGAGCTGCAGTCTCACAGCGAGAGAGGACGCTTTCTC[C/T]GAGACCTTCTGGAAAGAGGAGAGCAGCTTCCCGAGGTGCACAATCTTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b1azrl7z