ak5

Ensembl ID:
ENSDARG00000012555
ZFIN ID:
ZDB-GENE-030131-8256
Description:
adenylate kinase isoenzyme 5 [Source:RefSeq peptide;Acc:NP_001093554]
Human Orthologue:
AK5
Human Description:
adenylate kinase 5 [Source:HGNC Symbol;Acc:365]
Mouse Orthologue:
Ak5
Mouse Description:
adenylate kinase 5 Gene [Source:MGI Symbol;Acc:MGI:2677491]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25759 Essential Splice Site Mutation detected in F1 DNA During 2015
sa18317 Essential Splice Site Available for shipment Available now
sa2067 Nonsense F2 line generated During 2015

Mutation Details

Allele Name:
sa25759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Essential Splice Site 299 563 7 14
Genomic Location:
Chromosome 2 (position 8708027)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATATATATTGTACTGATTGTCTGACATGAGTGATTTTTCTTTTATGCA[G/T]CTTGATGCAGATCGAGATGAAGAGGAAGTCTTCTATGACATCAGCATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Essential Splice Site 369 563 9 14
Genomic Location:
Chromosome 2 (position 8654363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAGGCTGATGAAGAGGYGGCTGAATATGCAGAGGCGATTGGAGAAAG[T/C]GAGTGCAGTCTTTTNCAATGTATCTTCWTGCACTGTATTTGTGTGTGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2067
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Nonsense 427 563 11 14
Genomic Location:
Chromosome 2 (position 8647528)
KASP Assay ID:
554-3371.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCCTGTGCAGTGAGCTGCAGTCTCACAGCGAGAGAGGACGCTTTCTC[C/T]GAGACCTTCTGGAAAGAGGAGAGCAGCTTCCCGAGGTGCACAATCTTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b1azrl7z