ak5

Ensembl ID:
ENSDARG00000012555
ZFIN ID:
ZDB-GENE-030131-8256
Description:
adenylate kinase isoenzyme 5 [Source:RefSeq peptide;Acc:NP_001093554]
Human Orthologue:
AK5
Human Description:
adenylate kinase 5 [Source:HGNC Symbol;Acc:365]
Mouse Orthologue:
Ak5
Mouse Description:
adenylate kinase 5 Gene [Source:MGI Symbol;Acc:MGI:2677491]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32844 Nonsense Mutation detected in F1 DNA During 2016
sa25759 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18317 Essential Splice Site Available for shipment Available now
sa2067 Nonsense F2 line generated During 2016
sa32843 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Nonsense 291 563 6 14
Genomic Location (Zv9):
Chromosome 2 (position 8780355)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9198009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGCTTGACTAATTTCAAACAGAATGCCATCCCCCTGGTTAAATACTTC[C/T]AAGAAAAAGGCCTCATCGTCACAGTAAGGAATATGTTTGAATATTTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Essential Splice Site 299 563 7 14
Genomic Location (Zv9):
Chromosome 2 (position 8708027)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9125681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATATATATTGTACTGATTGTCTGACATGAGTGATTTTTCTTTTATGCA[G/T]CTTGATGCAGATCGAGATGAAGAGGAAGTCTTCTATGACATCAGCATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Essential Splice Site 369 563 9 14
Genomic Location (Zv9):
Chromosome 2 (position 8654363)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9072017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAGGCTGATGAAGAGGYGGCTGAATATGCAGAGGCGATTGGAGAAAG[T/C]GAGTGCAGTCTTTTNCAATGTATCTTCWTGCACTGTATTTGTGTGTGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2067
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Nonsense 427 563 11 14
Genomic Location (Zv9):
Chromosome 2 (position 8647528)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9065182
KASP Assay ID:
554-3371.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCCTGTGCAGTGAGCTGCAGTCTCACAGCGAGAGAGGACGCTTTCTC[C/T]GAGACCTTCTGGAAAGAGGAGAGCAGCTTCCCGAGGTGCACAATCTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Nonsense 480 563 13 14
Genomic Location (Zv9):
Chromosome 2 (position 8640822)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9058476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATCTGCTTGTGTGTGTGTGTATGTGTGTGTGTGTGTTTCAGATGGGC[C/T]AGCCAGACATAGTTCTGCTACTTGAATGTTCTGCAGACATCATGAGTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link