LOC100329634

Ensembl ID:
ENSDARG00000012535
Human Orthologues:
EPX, LPO, MPO
Human Descriptions:
eosinophil peroxidase [Source:HGNC Symbol;Acc:3423]
lactoperoxidase [Source:HGNC Symbol;Acc:6678]
myeloperoxidase [Source:HGNC Symbol;Acc:7218]
Mouse Orthologues:
Epx, Lpo, Mpo
Mouse Descriptions:
eosinophil peroxidase Gene [Source:MGI Symbol;Acc:MGI:107569]
lactoperoxidase Gene [Source:MGI Symbol;Acc:MGI:1923363]
myeloperoxidase Gene [Source:MGI Symbol;Acc:MGI:97137]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16079 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014363 Nonsense 399 766 9 14
Genomic Location:
Chromosome 25 (position 3096316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCTGACTTGTTGTATGTTGTTTGACAGATCTTGACGTGGGATCACTA[T/A]CTGCCACAYGTCCYGGGCCGCAGTGCAAACCAGATYCTCATGCCGGYGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fszyhm1d