si:ch73-250d21.2

Ensembl ID:
ENSDARG00000012534
ZFIN ID:
ZDB-GENE-081104-1
Description:
solute carrier family 6 (neurotransmitter transporter, taurine), member 6 [Source:RefSeq peptide;Ac
Human Orthologue:
SLC6A6
Human Description:
solute carrier family 6 (neurotransmitter transporter, taurine), member 6 [Source:HGNC Symbol;Acc:11
Mouse Orthologue:
Slc6a6
Mouse Description:
solute carrier family 6 (neurotransmitter transporter, taurine), member 6 Gene [Source:MGI Symbol;Ac

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21191 Essential Splice Site Available for shipment Available now
sa41116 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13500 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041794 Essential Splice Site 77 625 2 13
ENSDART00000146306 Essential Splice Site 77 625 3 14
Genomic Location (Zv9):
Chromosome 8 (position 7732940)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7119743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTAATGTCTGTATTAAGTGAAACTCATCTTACGTGTTGTTCTTTTCA[G/A]GTGCATTTCTCATCCCCTACTTCATCTTTCTGTTTGGTGGTGGTTTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041794 Essential Splice Site 324 625 6 13
ENSDART00000146306 Essential Splice Site 324 625 7 14
Genomic Location (Zv9):
Chromosome 8 (position 7746388)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7133191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAATGACTTCACTGGGAAGCTACAACAAGTACAAGTACAACTGTTACAG[G/A]TGAGGGTATGCTGTTGTGTATTTGTTTATGTTTTGTATCCACTGTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041794 Nonsense 527 625 12 13
ENSDART00000146306 Nonsense 527 625 13 14
Genomic Location (Zv9):
Chromosome 8 (position 7762582)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7149385
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTCACCTTTCTCTTTCAGGGTTGTTTTGTCTTTTCATTGGTGAAATA[C/A]AAGCCRCTGACTTATAACAAGCTTTACAAGTATCCTGATTGGTCCATTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link