NBEAL1

Ensembl ID:
ENSDARG00000012524
Description:
neurobeachin-like 1 [Source:HGNC Symbol;Acc:20681]
Human Orthologue:
NBEAL1
Human Description:
neurobeachin-like 1 [Source:HGNC Symbol;Acc:20681]
Mouse Orthologue:
Nbeal1
Mouse Description:
neurobeachin like 1 Gene [Source:MGI Symbol;Acc:MGI:2444343]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38536 Nonsense Mutation detected in F1 DNA During 2017
sa40626 Nonsense Mutation detected in F1 DNA During 2017
sa26667 Nonsense Mutation detected in F1 DNA During 2017
sa16584 Nonsense Available for shipment Available now
sa40627 Essential Splice Site Mutation detected in F1 DNA During 2017
sa25327 Essential Splice Site Mutation detected in F1 DNA During 2017
sa18594 Nonsense Available for shipment Available now
sa16324 Nonsense Available for shipment Available now
sa26669 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006221 Nonsense 160 2723 5 53
Genomic Location (Zv9):
Chromosome 6 (position 4155504)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4124048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCAGAAGAGTTTGTCCGTCACGCTCTGGCCTTCTGCGAGAGTCTGTA[T/A]GATCCCTACCACAACTGGAGGCATCGCATTCATGGGTGAGAAAAGCACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006221 Nonsense 586 2723 13 53
Genomic Location (Zv9):
Chromosome 6 (position 4173709)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4143115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTTCTGAGGCTCCTGCGTCAGGACGAGCCGGGCCGCGCTCACCCGTA[T/A]GTGGGACCGGTGCTGTGTTCACTGCTGGGGATGGTGCGCAAACAGGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26667
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006221 Nonsense 830 2723 16 53
Genomic Location (Zv9):
Chromosome 6 (position 4178468)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4147633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTCCCACATCACTGCAGGGCCAGCTGGGCAGTGTTATGGTCTTCCAC[G/T]AGCCGCTGCAGGCCACTCATGTCAAAGCCCTCTGTAGCGCAGGACCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16584
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006221 Nonsense 1114 2723 22 53
Genomic Location (Zv9):
Chromosome 6 (position 4183349)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4154502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGCAGATCTGAGTGAGGACGACATCAAGACAATYAGAGCTTCMCTTTA[C/A]GGCCTCCTCAAGTATTACATCAGCAAGGGAACCACTCAAGAGGAGATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006221 Essential Splice Site 1145 2723 22 53
Genomic Location (Zv9):
Chromosome 6 (position 4183444)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4154597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCAGAGCATTCTGGGATACATTGCTGCTATTGGAGATGAAGAACAGG[T/G]GAGGTCCAAACTGAACAATCTTGCTTATCTCAAACTTTTGAACAGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25327
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006221 Essential Splice Site 1252 2723 24 53
Genomic Location (Zv9):
Chromosome 6 (position 4191209)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4159405
KASP Assay ID:
554-7780.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACCTCCACCCTCATCAAGTGCCTCCTTCACCAAGTGCTGTCTACTGG[T/C]CAGTCTCATTCACACTTTAACACTTTAAACCACCCATGTTAGCAATCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18594
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006221 Nonsense 1437 2723 26 53
Genomic Location (Zv9):
Chromosome 6 (position 4194628)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4162746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTATGCAGAGCACGCCATMGCCTCTGGAGAACGCCAAACCRTTCCCT[G/T]GAGCTTCCTCTCTCAACGATGACAACTTCCTGTTCAGTGACAACGTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006221 Nonsense 2237 2723 42 53
Genomic Location (Zv9):
Chromosome 6 (position 4222282)
KASP Assay ID:
2259-7066.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTGTGTGTGCGTGTGCGTGTGCGTGTGTGTGTGTGTTTAGGAAT[C/A]AGAGTTYGTGTCRGCTCATCTGCATGAGTGGATCGATCTGAKCTTCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006221 Essential Splice Site 2690 2723 52 53
Genomic Location (Zv9):
Chromosome 6 (position 4233037)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4200042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGAGGACGGCAAGCTGATCGTGGTGGGCGTCGGGAAACCAGCGGAGG[T/C]AAAAAACTCCTTCAGGAACTACATCACCCAGCGGATGGAGGGCTCGCCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link