hcfc1b

Ensembl ID:
ENSDARG00000012519
ZFIN ID:
ZDB-GENE-030131-2411
Description:
host cell factor C1b [Source:RefSeq peptide;Acc:NP_001122009]
Human Orthologue:
HCFC1
Human Description:
host cell factor C1 (VP16-accessory protein) [Source:HGNC Symbol;Acc:4839]
Mouse Orthologue:
Hcfc1
Mouse Description:
host cell factor C1 Gene [Source:MGI Symbol;Acc:MGI:105942]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34295 Nonsense Mutation detected in F1 DNA During 2017
sa7624 Missense Mutation detected in F1 DNA During 2017
sa38667 Nonsense Mutation detected in F1 DNA During 2017
sa38666 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34295
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019533 Nonsense 801 1990 14 27
ENSDART00000132536 Nonsense 804 1993 15 28

The following transcripts of ENSDARG00000012519 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 8078389)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7523026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGGGAAAATCATCACAGCTGTGCCTAAGCTGACAGGTGCAGGACAA[C/T]AGGGAGTCACACAGGTGAGGCCCAACTGATTTCAAATCAGTAAAAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7624
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019533 Missense 891 1990 16 27
ENSDART00000132536 Missense 894 1993 17 28

The following transcripts of ENSDARG00000012519 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 8076483)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7521120
KASP Assay ID:
554-4356.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCCAGCCTGGCGACTCCTGTCACCACACTGGCCTCCATCGCCACTTTA[T/C]CCAGCCAGGTGATCAATCCCACAGCCATCACTGTATCTGCTGCCCAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38667
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019533 Nonsense 1179 1990 17 27
ENSDART00000132536 Nonsense 1182 1993 18 28

The following transcripts of ENSDARG00000012519 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 8073405)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7518042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACCTTGCGAGACGCGTGAAACGGGCACCACTAGTACACCTACACAAT[C/A]AAGCGCAGATATGGAGAGTGGACAGAGTGGTTCTGTGCAAAGGGTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019533 Nonsense 1806 1990 24 27
ENSDART00000132536 Nonsense 1809 1993 25 28

The following transcripts of ENSDARG00000012519 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 8051118)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7495755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTATTGACTCTGTTGCAGGACGATTCTGGCGCAATCCCAGACTACAGC[C/T]GAATGAAGAAAATCGAGTTGTCTCCGGGCACTGCTTACAAGTTCCGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link