sdcbp2

Ensembl ID:
ENSDARG00000012513
ZFIN ID:
ZDB-GENE-030131-3727
Description:
syntenin-1 [Source:RefSeq peptide;Acc:NP_997856]
Human Orthologue:
SDCBP2
Human Description:
syndecan binding protein (syntenin) 2 [Source:HGNC Symbol;Acc:15756]
Mouse Orthologue:
Sdcbp2
Mouse Description:
syndecan binding protein (syntenin) 2 Gene [Source:MGI Symbol;Acc:MGI:2385156]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37652 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37651 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020810 Essential Splice Site None 299 1 9
ENSDART00000136496   None 267 None 7
Genomic Location (Zv9):
Chromosome 23 (position 16852708)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16755647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACATTAAACCCATTTCTTCAGAAGTCGCTTGTTTGAAAGCAGAAAG[G/T]TAAGACGCGATGATCTTTAGTATAGATGTTGTTATTTTAGTTGTCGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020810 Nonsense 185 299 6 9
ENSDART00000136496 Nonsense 185 267 5 7
Genomic Location (Zv9):
Chromosome 23 (position 16825102)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16728041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCTGGAATTCAGATAAGGCCCATAAAGCTCTGAAGGCAGCAGCAGAA[C/T]AGCGCATCGAGCTCATCGTTCGAGACAGGTCAGTCCTTTCTGACTGTAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link