rnpep

Ensembl ID:
ENSDARG00000012506
ZFIN ID:
ZDB-GENE-040718-241
Description:
aminopeptidase B [Source:RefSeq peptide;Acc:NP_001002741]
Human Orthologue:
RNPEP
Human Description:
arginyl aminopeptidase (aminopeptidase B) [Source:HGNC Symbol;Acc:10078]
Mouse Orthologue:
Rnpep
Mouse Description:
arginyl aminopeptidase (aminopeptidase B) Gene [Source:MGI Symbol;Acc:MGI:2384902]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21906 Nonsense Available for shipment Available now
sa21907 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005616 Nonsense 421 626 8 11
ENSDART00000133481 None None 276 None 5
Genomic Location:
Chromosome 11 (position 25715534)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGTGCTGATAAACATGTCAAAACAGTGACTGTGTCTCTTCAAGGCTTA[T/A]GTGGAGAAGTTCAAGTTCAGAAGTGTGCTGGCCGAGGATGCGCTGGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005616 Nonsense 569 626 10 11
ENSDART00000133481 None None 276 None 5
Genomic Location:
Chromosome 11 (position 25716161)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGCGATGGGCTCAGATTGTTGCAAAAAACCAGTATAGTCCAGGATTC[C/T]AGCACATTCGGGATTTCCTCTCAAGCCAGGTCAGATTTTCTACTTTATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Butyrylcholinesterase levels: GWAS of butyrylcholinesterase activity identifies four novel loci, independent effects within BCHE and secondary associations with metabolic risk factors. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q7ixgkm3