rlbp1a

Ensembl ID:
ENSDARG00000012504
ZFIN ID:
ZDB-GENE-040426-1662
Description:
retinaldehyde binding protein 1a [Source:RefSeq peptide;Acc:NP_956999]
Human Orthologue:
RLBP1
Human Description:
retinaldehyde binding protein 1 [Source:HGNC Symbol;Acc:10024]
Mouse Orthologue:
Rlbp1
Mouse Description:
retinaldehyde binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:97930]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20873 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006897 Nonsense 70 312 3 7
Genomic Location (Zv9):
Chromosome 7 (position 14753074)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13634087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAGATGAGAAGAGAGCGTCTGCTATAAAGGAACTCAGAGCCATGATT[A/T]AAGACAAGGCAGGCCAAGGAGATGAGGTGGCCAAAACTGTGCAAGACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link